Knock-In Cell Line

Gene knock-in (KI) is a precise gene editing technique used to insert exogenous gene sequences into specific sites of the genome, allowing stable expression in cells.

Technical Principle
DNA double-strand break (DSB) is the key step in gene knock-in. This break triggers two main DNA repair pathways in cells: non-homologous end joining (NHEJ) and homology-directed repair (HDR).
The core of the knock-in process involves using a gRNA or crRNA to guide the Cas enzyme to cut the DNA at a target site. The cell then uses an externally provided donor template to repair the break. Depending on the mechanism—HDR or NHEJ—the desired gene sequence is precisely inserted into the genome.

基因敲入基本技术原理-艾迪基因
Basic Principles of Gene Knock-In Technology
Over more than a decade, EDITGENE has built extensive expertise in gene editing. We have developed four gene knock-in platforms: HES-KI、CRISPaint、 Bingo™ 和CRISPR/HDR. Each method is designed to meet diverse knock-in needs, delivering breakthroughs in both efficiency and precision. These technologies help streamline the process of generating knock-in cell lines.
Service Efficiency Advantages Applicable Scenarios
CRISPR/HDR 5-30% Highly versatile – ideal for introducing point mutations or inserting DNA fragments Actively dividing cells
CRISPaint 20-50% Works independently of the cell cycle Cells with slow or infrequent division
Bingo™ 30-80% No need for double-strand breaks or donor templates – low off-target risk Precise small-fragment knock-ins or single-base corrections
HES-KI 40%-90% Built-in screening system ensures efficient knock-in C-terminal tagging at essential gene loci

Applications
Industrial Production: Delivers high stability and uniformity of target gene expression, ensuring consistent yield and quality in large-scale manufacturing.
Gene Therapy: Enables stable integration of therapeutic genes in cell-based treatments.
Stem Cell Engineering: Achieves efficient transgene knock-in in iPSCs.
Functional Genomics: Facilitates screening of essential gene domains and regulatory elements.
Disease Modeling: Generates genetically modified cell lines that reflect physiologically relevant expression levels.

Service Details

Cell Types Tumor cells, stem cells, and various other lines.
Click to view the full cell line list.
Service Options Targeted knock-in of fluorescent proteins, tag proteins, or at custom loci
Delivery Standard One monoclonal stable cell line (2 cryovials, 1×10⁶ cells per vial)
Turnaround/Price   Available upon request – chat with us online

HES-KI Technology

 

HES-KI Technology Overview

HES-KI (Hotspot-Exon-Selection Knock-In) is a novel knock-in strategy targeting the C-terminal exon region of essential genes using CRISPR editing. A custom knock-in template is designed so that successful integration restores the function of the essential gene while incorporating the desired transgene. In contrast, cells with failed knock-in—such as those with indels caused by NHEJ—lose essential gene function and cannot survive. This enables effective enrichment of correctly edited cells through a built-in positive selection mechanism.

HES-KI Advantages

High Efficiency
The positive selection mechanism significantly boosts knock-in efficiency—reaching up to 68% in various cell types—far surpassing traditional methods by reducing non-specific integration
Stable and Uniform Expression
Knock-in monoclonal cell lines show consistent and stable expression of the target gene
Multiplex Gene Integration
Supports simultaneous integration of multiple genes. For example, multiple CAR genes can be inserted to target various tumor antigens and minimize tumor immune escape
Tunable Expression
By selecting different essential genes as integration sites, the expression level of the transgene can be flexibly modulated

HES-KI Case Study

Case 1: AsCas12-Mediated HES-KI

Objective:Insert EGFP at the C-terminus of the GAPDH gene in K562 cells

Design:

Result:
• Using the HES-KI technology, EGFP was successfully knocked into the GAPDH locus in K562 cells. Without any antibiotic selection, the polyclonal knock-in efficiency reached 37%, demonstrating the high efficiency of the platform even under non-selective conditions.

• No significant difference in doubling time was observed between EGFP-KI K562 clones and wild-type K562 clones, indicating that EGFP insertion does not affect cell growth.
• EGFP-KI monoclonal cells showed consistent EGFP mRNA expression levels, reflecting high clonal uniformity.
• The EGFP-KI K562 monoclonal cell line maintained stable EGFP mRNA expression levels after 15 consecutive passages.

• K562 EGFP-KI cells images
K562 EGFP-KI polyclonal cells
K562 EGFP-KI monoclonal cells
Case 2: Cas9-Mediated HES-KI

Objective:Insert EGFP at the C-terminus of the GAPDH gene in 293T and CHO-K1 cells

Design:

Result:
•  Using the HES-KI technique, the knock-in efficiency of EGFP reached 68% in 293T polyclonal cells and 55% in CHO-K1 polyclonal cells.


• Images of 293T and CHO-K1 EGFP-KI polyclonal cells
293T CHO-K1
 
 

CRISPaint Gene Knock-in

 

CRISPaint Technology Overview

CRISPaint is a gene knock-in technique based on the CRISPR-Cas9 system. It leverages the cell's own non-homologous end joining (NHEJ) repair mechanism to insert exogenous DNA fragments at the specified C-terminal position of a target gene, without relying on homologous recombination (HDR). The CRISPaint design is highly flexible, making it suitable for various gene function studies and genome editing applications.

Core Technical Principles

1. CRISPR-Cas9-Mediated Double-Strand Break (DSB)
The CRISPR-Cas9 system induces a double-strand break at the target genomic location, activating the cell's DNA repair mechanisms.


2. Universal Donor Vector Design
CRISPaintCRISPaint uses a universal donor DNA template to implement a flexible knock-in strategy through three key components:
Target sgRNA plasmid: Cuts at the specific location in the gene.
Frame sgRNA plasmid: Cuts the donor plasmid to linearize it within the cell. Three types of frame sgRNAs are available to ensure correct open reading frame (ORF) expression of the inserted gene.
Universal Donor plasmid: Contains the gene sequence to be inserted (e.g., a fluorescent protein) along with the target sequences for the three types of Donor sgRNAs.

3. Non-Homologous End Joining (NHEJ)
The target gene forms a double-strand break (DSB), and the donor is cut. The cell uses the NHEJ repair mechanism to integrate the linearized donor template into the DSB site, enabling efficient gene knock-in.

CRISPaint Technical Advantages

High Efficiency
NHEJ-mediated gene knock-in requires no homology arms, achieving an insertion efficiency of up to 50%
Wide Applicability
Independent of cell division, suitable for various cell types
Flexibility
The universal donor plasmid contains three different Donor-sgRNA target sequences, allowing flexible selection of Frame sgRNAs for correct gene ORF integration

CRISPaint Experimental Workflow

 

CRISPaint Case Study

Case 1
Objective: C-terminal knock-in of Neo resistance gene at gene A in hESC H9 cells
Design: Donor plasmid design




Experimental Workflow


Results:
• Sanger sequencing confirmed the precise insertion of the Neo gene at the C-terminus of gene A in H9 cells.
 width=

 

Bingo™-Mediated Gene Knock-In

 

Bingo™ Technology Overview

Prime Editing (PE) is a gene editing technique designed for precise insertion of small DNA fragment, without introducing double-strand breaks (DSBs). The method uses a Cas9 nickase fused to a reverse transcriptase (Cas9n-RT), guided by a prime editing guide RNA (pegRNA) to the target site. Cas9n creates a single-strand nick, and the reverse transcriptase uses the pegRNA template to synthesize the desired DNA sequence at that site, achieving accurate gene insertion.

 

Bingo™ Technical Advantages

Safer
PE technology edits the genome via single-strand nicking, avoiding the instability associated with DSBs and significantly improving overall safety.
Highly precise
The pegRNA contains detailed edit instructions, enabling accurate fragment insertion and minimizing off-target or unintended edits.
Versatile
Supports insertion of small DNA sequences such as stop codons or tag sequences, making it suitable for a wide range of genome editing applications.

Bingo™ Experimental Workflow

 

 

 

Bingo™ Case Study

Case 1
Construction of HCT116 Cell Line with EGFR Gene Point Mutation (c.2319_2320 ins CAC)

Project Information
Cell Name HCT116
Gene EGFR(Gene ID: 1956)
Mutation Site c.2319_2320 ins CAC
Bingo™Bingo™ PE system plasmid design
SpacerGCCCAGCAGGCGGCACACGTG
Bingo™ pegRNA Spacer GCCCAGCAGGCGGCACACGTG
Extension GTGGACAACCCCCACcacGTGTGCCGC
Bingo™ gRNA GCACcacGTGTGCCGCCTGCT


Editing efficiency detection
• Polyclonal sequencing results of EGFR gene point mutation (c.2319_2320 ins CAC) in HCT116 cell pool.


• HCT116 cell line with EGFR gene point mutation shows an editing efficiency of 38% in polyclonal cells.

 

CRISPR/HDR Gene Knock-In

 

CRISPR/HDR Technology Overview

CRISPR/HDR is a gene editing approach that integrates foreign DNA through the CRISPR system and the cell’s homology-directed repair (HDR) pathway. The sgRNA guides Cas9 to a specific target site, where it introduces a double-strand break (DSB). A donor DNA template containing homology arms is then precisely inserted at the break site through HDR, enabling accurate gene knock-in.

 

CRISPR/HDR Technical Advantages

 

Highly flexible
By adjusting the sgRNA and donor template, foreign gene sequences can be inserted at various genomic locations
Highly accurate
The HDR pathway allows precise integration of the donor DNA at the cut site, minimizing unexpected mutations (indels) at the junction

CRISPR/HDR Workflow

 

Advantage and Characteristic

Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic

Reference Materials

Article Title: Modulation of cell cycle increases CRISPR-mediated homology-directed DNA repair

This study explores a method to enhance CRISPR-mediated HDR efficiency by synchronizing the cell cycle. Using small molecules to modulate the cell cycle, researchers achieved a 1.2- to 1.5-fold increase in knock-in efficiency across various cell lines. The study also demonstrated this approach's application in animal embryos, significantly increasing knock-in frequency in pig embryos. This technique improves knock-in success by guiding cells to an HDR-favorable cycle stage, offering a new optimization strategy for CRISPR gene editing.

Article Title: CLASH enables large-scale parallel knock-in for cell engineering

The CLASH (Cas9-Linked Adaptor Synthesis for Homology-directed repair) technology enables efficient large-scale gene knock-in for cell engineering. This method combines the Cas9 protein and adaptor synthesis, allowing parallel knock-in across various cell types. By providing specific adaptors during the DNA repair process, it significantly enhances homology-directed repair (HDR) efficiency, thereby increasing knock-in success rates. This technology shows great potential in cell engineering and gene editing, especially for complex bioengineering applications requiring multi-gene modifications.

FAQ

Gene knock-in technology involves inserting an exogenous gene sequence into a specific location within the genome for gene function studies or disease treatment. Edigene utilizes advanced gene editing tools, such as the CRISPR/Cas9 system, to guide nucleases to cut the target DNA, and employs homology-directed repair or non-homologous end joining to accurately insert the gene at the desired location, achieving efficient and precise gene knock-in.
Gene knock-in plays a crucial role in drug development. It is used in target validation by introducing specific genes into cell lines or animal models to confirm drug target efficacy. It also aids in establishing disease models, testing drug efficacy and safety in these models, and supporting drug screening through high-throughput screening in knock-in cell lines to identify potential drug candidates. Additionally, gene knock-in helps uncover drug mechanisms, optimize drug structure, and improve dosing strategies, expediting drug development while enhancing efficacy and safety.
EDITGENE’s advantages in gene knock-in technology include: Guaranteed results: With 10 years of CRISPR gene editing experience and a team of PhDs from world-renowned institutions offering one-on-one support. High precision: EDITGENE’s optimized tools reduce off-target effects, enhancing editing accuracy. High efficiency: EDITGENE’s technology platform improves knock-in success rates, accelerating experimental progress. Customized service: Tailored knock-in solutions to meet specific research or therapeutic goals.
Contact Us
*
*
*
*
How did you hear about us: