Login
RNP Delivery
RNP delivery of the CRISPR/Cas editing system involves mixing chemically synthesized sgRNA/crRNA targeting the desired gene with Cas proteins in vitro to form a ribonucleoprotein (RNP) complex. This RNP complex is then delivered into cells via electroporation or RNP transfection reagents, allowing the sgRNA/crRNA to guide the Cas protein to the target gene for precise editing.
Advantages of RNP Delivery:
1. Low Cytotoxicity: Compared to plasmid-based delivery, RNP delivery induces much lower cytotoxicity and is rapidly degraded after gene editing is completed.
2. Broad Cell Delivery Range: Applicable to a wide range of cell types, including hard-to-transfect cells like immune and stem cells.
3. Fast and Efficient: No need to construct CRISPR/Cas expression vectors or wait for the expression of CRISPR/Cas editing components.
Service Details
| Applications | 1. Gene function exploration and validation2. Disease treatment3. Gene editing drug discovery |
|---|---|
| Turnaround/Price |
 Consult online for details |
RNP Gene Delivery Service from EDITGENE
EDITGENE, with over ten years of gene editing experience, offers RNP gene delivery services based on our exclusive sgRNA/crRNA design strategies, self-developed high-efficiency gene editing Cas enzymes, CRISPR-EDITx™ Tran RNP transfection reagent, and a well-established RNP delivery experimental system.
EDI-Service Advantages
High-efficiency sgRNA/crRNA design and synthesis
Proprietary high-efficiency sgRNA/crRNA design algorithm; synthesis of various qualities of sgRNA/crRNA available (HPLC grade, desalting grade, etc.).
High-activity Cas proteins
Optimized Cas proteins and a well-established protein purification platform provide highly active Cas proteins.
Multiple delivery methods
Including electroporation, RNP transfection reagents, and more.
CRISPR EDITx™Tran RNP high-efficiency transfection reagent
30 minutes to complete transfection, and gene editing efficiency detectable within 48 hours.
Workflow
Case Study
Using CRISPR EDITx™ Tran RNP high-efficiency transfection reagent to mediate RNP (AsCas12a + crRNA) to knock out the B2M gene in THP-1 cells.
· crRNA Design
crRNA: UAAUUUCUACUCUUGUAGAUCAUUCUCUGCUGGAUGACGU
B2M gene editing site diagram
· Editing efficiency detection
After 48 hours of transfection, cells were collected for editing efficiency detection, and ICE Analysis showed an editing efficiency of approximately 95%.
B2M sequencing results
RNP-Mediated Gene Editing Efficiency in Selected Cell Types
| Cell Type | Cell Source | Knockout Efficienc |
|---|---|---|
| THP-1 | Human Monocytic Leukemia Line | ★★★★ |
| Hela | Human Cervical Cancer Line | ★★★★ |
| A549 | Human Non-Small Cell Lung Cancer Line | ★★★ |
| C2C12 | Mouse Myoblast Line | ★★★ |
| MDA-MB-231 | Human Breast Cancer Line | ★★★ |
| SNU-449 | Human Liver Cancer Line | ★★★ |
| H1975 | Human Lung Adenocarcinoma Line | ★★★ |
*Knockout Efficiency（%）：★★★★＞81％，★★★ 51~80％
All cell types were transfected with RNP using EDITGENE’s proprietary CRISPR EDITx™Tran high-efficiency transfection reagent.
Literature Review
The CRISPR/Cas9 system is a powerful tool for genome editing, but there are certain risks associated with gene delivery strategies, as they may lead to unwanted gene editing and integration mutations in host cells. Therefore, it is crucial to develop a method that can directly and efficiently deliver the Cas9 protein complex and guide RNA (sgRNA) into the cytoplasm and subsequently transfer them into the nucleus. Mout et al. achieved this by engineering Cas9 proteins and nanoparticle carriers. They developed a system in which the Cas9 protein complex self-assembles with cationic arginine gold nanoparticles (ArgNPs) to form nanoassemblies. These nanoassemblies efficiently deliver both proteins and nucleic acids directly into the cytoplasm and transfer them to the nucleus, enabling effective gene editing.
Rational engineering of Cas9 protein and arginine nanoparticles (ArgNPs) for intracellular delivery of Cas9 protein or Cas9-RNP via membrane fusion
Mout R, Ray M, Yesilbag Tonga G, Lee YW, Tay T, Sasaki K, Rotello VM. Direct Cytosolic Delivery of CRISPR/Cas9-Ribonucleoprotein for Efficient Gene Editing. ACS Nano. 2017 Mar 28;11(3):2452-2458. doi: 10.1021/acsnano.6b07600. Epub 2017 Jan 31. PMID: 28129503; PMCID: PMC5848212.
Advantage and Characteristic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
FAQ
What issues should be considered when culturing cells for gene delivery?
Maintaining the activity of cell cultures is crucial. Cells should not be allowed to reach confluence for more than 24 hours. Frozen new cells can restore transfection activity. The optimal cell plating density varies for different cell types or applications; however, for adherent cells, a confluence of 70% to 90% or a density of 5×10^5 to 2×10^6 suspended cells/ml typically yields good transfection results. It is important to ensure that cells are not fully confluent or in a fixed phase during transfection.
How to choose the appropriate gene delivery method?
Selecting a suitable gene delivery system requires a comprehensive assessment based on specific experimental conditions, research objectives, and cell types. Quantitatively comparing various systems in terms of delivery efficiency, cytotoxicity, and stability is an important step in determining the choice.
Viral delivery systems are suitable for experiments that require high delivery efficiency and sustained gene expression, especially when cells can tolerate higher levels of cytotoxicity and immune responses. If lower cytotoxicity and immune response, along with ease of use and cost-effectiveness, are priorities, then a liposome-based gene delivery system should be chosen. For high delivery efficiency that involves delivering large DNA fragments, and if the user can accept a higher operational complexity, a gene gun delivery system is an optional method. If high delivery efficiency is needed while maintaining relative simplicity and no special equipment is required, then the electroporation delivery system may be a suitable choice.
Viral delivery systems are suitable for experiments that require high delivery efficiency and sustained gene expression, especially when cells can tolerate higher levels of cytotoxicity and immune responses. If lower cytotoxicity and immune response, along with ease of use and cost-effectiveness, are priorities, then a liposome-based gene delivery system should be chosen. For high delivery efficiency that involves delivering large DNA fragments, and if the user can accept a higher operational complexity, a gene gun delivery system is an optional method. If high delivery efficiency is needed while maintaining relative simplicity and no special equipment is required, then the electroporation delivery system may be a suitable choice.
