Point Mutation Cell Line

Point mutation cell lines are generated by introducing specific SNP, single-base substitutions or small nucleotide insertions/deletions at specific sites of a target gene. This approach enables precise modeling of disease-associated mutations and facilitates the study of gene function and protein structure. Compared with conventional gene editing methods, point mutations allow refined modifications without disrupting the overall gene architecture, providing researchers with cell models that more closely reflect physiological conditions.

Leveraging our optimized CRISPR/Cas9 and Prime Editing platforms, together with efficient sgRNA design and stringent single-clone screening, EDITGENE offers customized point mutation cell lines of various types. Our services feature editing efficiencies of up to 98%, off-target rates as low as 0.1%, and comprehensive validation, helping accelerate the progress of research projects.
Find 100+ Ready-to-Use mutant Cell Lines→

Service Details

Cell Types Various cell types, including tumor, conventional, stem, primary, and immortalized cell lines.
Services Prime Editing / Base Editing / HDR
Deliverables Gene point mutation monoclonal cell line ≥ 1 clone (2 vials per clone, 1×10^6 cells per vial)
Turnaround/Price As fast as 8 weeks,as low as $4500   Consult online for details

EDI-Service Advantages 

Efficient Editing System
With the Bingo™ 7 gene editing strategy, editing efficiency is increased by 4.1-fold, enabling effective editing even at sites that were previously difficult to modify.
Optimized pegRNA Design
Proprietary algorithms ensure precise and reliable pegRNA design.
Enhanced Cas9n-RT Enzyme
Optimized Cas9n-RT enzyme with improved activity and stability for superior editing outcomes.
Advanced Transfection System
Exclusive transfection system with 10x efficiency over traditional methods.
Streamlined Monoclonal Screening
3D printing technology enables efficient isolation of positive clones
Experienced Team
Expert team with over 1000 gene editing projects and experience across 300+ cell types.

Comparison of Point Mutation Methods

Feature Prime Editing Base Editing HDR
Requirement for DSB No (single-strand nick only) No Yes
Editing type Point mutations, small insertions or deletions Limited to C→T or A→G conversions Any type (requires donor template)
Efficiency High High Low (<10%; depends on cell division, can be improved with NHEJ inhibitors such as SCR7)
Applicable cells Dividing and non-dividing cells Dividing and non-dividing cells Mainly dividing cells
Off-target risk Low Medium (bystander editing possible) High (NHEJ-mediated indels)

Service Types

Prime editing combines nCas9 with a reverse transcriptase to enable targeted point mutations as well as small insertions or deletions, without relying on DNA double-strand breaks (DSBs) or exogenous donor DNA templates.

Working Principle

Prime Editing Working Principle

Base editors are CRISPR-Cas–based tools that catalyze specific base conversions in DNA or RNA (e.g., C→T, A→G) without generating DNA double-strand breaks (DSBs). They achieve single-base modification by fusing a deaminase enzyme with a catalytically impaired or partially impaired Cas protein, making them well-suited for high-precision gene editing with minimal side effects.

Working Principle

Base Editing Working Principle

Homology-directed repair (HDR) is a strategy for precise genome editing that requires an exogenous donor DNA template. It is commonly used for knock-in, the introduction or large-fragment replacements of point mutations.

Working Principle

HDR Working Principle

Case Study

Using EDITGENE’s Bingo™ platform, pegRNAs and nick sgRNAs were designed for the target loci, and plasmid sequences were verified by sequencing. The plasmids, including the auxiliary plasmids and pegRNAs/nick sgRNAs, were transiently transfected into cells. Genomic DNA was subsequently extracted to confirm the introduction of the desired point mutations.
Cell type cell pool editing efficiency Sequencing peak profile Number of single clones selected Number of homozygous single clones
A549 98% WT:GAGTTGCGCATTAACAGTGGTGGGA
MT:GAGTTGCGCATTAACGGTGGTGGGA
Sequencing chromatogram of a single-base point mutation cell line generated in A549 cells using Prime Editing.
7 6
K562 82% WT:GTGGAGAAGCCCTTCGGGAGGGACC
MT:GTGGAGAAGCCCCTCGGGAGGGACC
Sequencing chromatogram of a single-base point mutation cell line generated in K562 cells using Prime Editing.
6 4
IPSC 60% WT:AGGGAACCCCAAGTTGAACTTGGCTT
MT:AGGGAACCCCAAGTTCAACTTGGCTT
Sequencing chromatogram of a single-base point mutation cell line generated in iPSC cells using Prime Editing.
8 2
Using the Bingo™ platform, pegRNAs and nick sgRNAs were designed and plasmid sequences verified by sequencing. The plasmids were transiently transfected into A549 cells, and genomic DNA was extracted to validate the double-point mutations.
Cell type cell pool editing efficiency Sequencing peak profile Number of single clones selected Number of homozygous single clones
A549 56% and 63% WT:CAGTCCTCAAAATCTCCATCCCTGT
MT:CAGTCCTCAAAACCCCCATCCCTGT
Sequencing chromatogram of a double-site mutation cell line generated in A549 cells using Prime Editing.
4 2
Target-site pegRNAs and nick sgRNAs were designed on the Bingo™ platform, and plasmid sequences were verified. The plasmids were transiently transfected into A549 cells, and genomic DNA was extracted to confirm the base insertions.
Cell type cell pool editing efficiency Sequencing peak profile Number of single clones selected Number of homozygous single clones
Hela 64% WT:TCCGCTACCACCAATGCCTAATGCATTTGG
MT:TCCGCTACCACCAATGCTAATAACTAATGCATTTGG
Sequencing chromatogram of a base insertion cell line generated in HeLa cells using Prime Editing.
11 1

Advantage and Characteristic

Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic

Reference Materials

Article Title: Structural basis for pegRNA-guided reverse transcription by a prime editor

The molecular mechanism of how the Prime editor recognizes pegRNA and interacts with target DNA remains unclear, limiting the understanding and optimization of the prime editing process. To address this, researchers determined the cryo-electron microscopy (cryo-EM) structure of the Prime editor in various states, providing a structural framework for understanding this innovative genome engineering system.
Using cryo-EM technology, researchers analyzed the Prime editor complex’s structure in different states, including pre-initiation, initiation, extension, and termination, successfully obtaining high-resolution structures that reveal dynamic changes in the reverse transcription guidance process. Based on structural information, researchers designed pegRNA and Prime editor variants, truncating and fusing M-MLV RT to create a smaller Prime editor variant (PECO-Mini) that maintained editing efficiency while increasing AAV vector titers and prime editing efficiency. Activity testing results showed that the engineered Prime editor variant has comparable activity to the original Prime editor in vitro. This study reveals the structural characteristics of the Prime editor complex in various working states, providing key information for understanding its molecular mechanism.

Article Title: A truncated reverse transcriptase enhances prime editing by split AAV vectors

Prime editing is a novel CRISPR-based genome-editing technology that does not require double-strand DNA breaks or exogenous donor template DNA, showing great potential in biomedical research and gene therapy. Despite its versatility and precision, prime editing efficiency varies across different editing types, target sites, and cell types. Therefore, to expand its applications, there is a need to improve prime editing efficiency.
Researchers screened 11 different RT variants, optimized with GenScript algorithm for human codons, which increased PE protein expression levels by 1.4-fold. By deleting the RNase H domain and further shortening the RT sequence, they created multiple truncated PECO variants, reducing the Prime editor length by 621 bp without compromising editing efficiency. To enable efficient dual-AAV delivery of PE, the team constructed a split PE system based on different Cas9 cleavage sites and inteins, identifying cleavage sites Rma 573-574 and 674-675. When these sites were paired with Rma intein, they significantly increased AAV vector titers and Prime editor efficiency. Through engineering and optimization, researchers successfully enhanced Prime editing efficiency and resolved AAV size constraints, providing a more efficient tool for future gene therapy and biomedical research.

Article Title: Structural basis for pegRNA-guided reverse transcription by a prime editor

This article elucidates the structural basis of pegRNA-guided reverse transcription in prime editing technology. High-resolution structural analysis revealed the three-dimensional conformation of key proteins in the Prime Editor, including Cas9 and reverse transcriptase, and their interaction with pegRNA. It details how pegRNA guides the Prime Editor to recognize specific DNA sequences and perform reverse transcription, inserting a predetermined gene sequence into the target site. The study also discusses the roles of key amino acid residues in pegRNA binding and reverse transcription, providing insight into the precise mechanisms of these molecular interactions. This finding not only deepens our understanding of the Prime Editing mechanism but also offers valuable structural information for optimizing and improving this technology, advancing its application in gene therapy and other fields.

Article Title: Ex vivo prime editing of patient haematopoietic stem cells rescues sickle-cell disease phenotypes after engraftment in mice

Sickle-cell disease (SCD) is an autosomal recessive genetic disorder caused by an A·T to T·A point mutation in the β-globin gene (HBB). Currently, the only FDA-approved cure for SCD is allogeneic hematopoietic stem cell transplantation; however, most patients lack ideal donors, and this procedure can lead to severe toxicity. Correcting a patient’s own hematopoietic stem cells (HSCs) can bypass immune complications and eliminate the need for matched donors. Clinical trials are ongoing to correct the SCD mutation using Cas9 nuclease-initiated homology-directed repair (HDR) and adeno-associated virus type 6 (AAV6)-delivered DNA templates.
In this article, researchers applied an optimized prime editing system to correct HSPCs from SCD patients ex vivo. By electroporating PEmax mRNA along with synthetic epegRNA and nicking sgRNA, the SCD allele (HBBS) was successfully corrected back to the wild-type (HBBA), with correction rates between 15% and 41%. Subsequently, edited HSPCs were transplanted into immunodeficient mice, and 7 weeks later, edited HSPCs maintained HBBA levels in the bone marrow, with engraftment rates, hematopoietic differentiation, and lineage maturation similar to unedited healthy donor HSPCs. Therapeutic evaluation revealed that, post-transplant, 42% of red blood cell precursors and reticulocytes expressed HBBA, exceeding the predicted therapeutic benefit level. Gene-specific analyses also confirmed high DNA specificity of the prime editing system. The study demonstrates the potential of prime editing in SCD treatment, showing its effectiveness in improving therapeutic outcomes while reducing off-target editing risks.

Article Title: Generation of Human Isogenic Induced Pluripotent Stem Cell Lines with CRISPR Prime Editing

With advancements in human molecular genetics and genomics, thousands of gene loci associated with common disease risks have been identified, often containing multiple candidate variants. However, most disease-associated variants are non-coding, making it challenging to elucidate the molecular mechanisms underlying these variants. The development of CRISPR technology provides a more precise approach for targeted genome editing, particularly prime editing, which can mediate nearly any single-nucleotide substitution. Consequently, many researchers hope to apply prime editing to study the functional relevance of specific gene variants in pluripotent stem cells, enabling the generation of isogenic cell lines to control genetic background while assessing the dose effect of causal alleles.
In this article, researchers developed an efficient CRISPR prime editing technology to generate cell lines carrying heterozygous or homozygous alleles in induced pluripotent stem cells (iPSCs) and optimized the prime editing technique. Six single-nucleotide variants (SNVs) associated with Type 2 Diabetes (T2D) risk were selected for editing, and iPSCs derived from human donors with different genetic backgrounds were edited at each site. The researchers successfully generated 27 edited iPSC clones covering 6 SNVs associated with T2D or congenital hyperinsulinemia (CHI) and found that prime editing was more efficient in iPSCs than in HEK293T cells. Overall, this study demonstrates the potential of prime editing for generating iPSCs with specific genetic backgrounds, providing a powerful tool to study the effects of specific genetic variants on disease.

Selected Customer Resources

IF=50.5
Nature

Abstract:

To date, more than half of global hepatocellular carcinoma (HCC) cases occur in China, yet comprehensive whole-genome analyses focusing on HBV-related HCC within the Chinese population remain scarce. To address this challenge, researchers initiated the China Liver Cancer Atlas (CLCA) project, aiming to conduct large-scale whole-genome sequencing to unravel the unique pathogenic mechanisms and evolutionary trajectories of HCC in China.

The researchers performed deep whole-genome sequencing on 494 HCC tumor samples, with an average depth of 120×, alongside matched blood controls, providing a detailed genomic landscape of HBV-associated HCC. Beyond confirming well-known coding driver genes such as TP53 and CTNNB1, the study identified six novel coding drivers—including FGA—and 31 non-coding driver genes.

Additionally, the research uncovered five new mutational signatures, including SBS_H8, and characterized the presence of extrachromosomal circular DNA (ecDNA) formed via HBV integration, which contributes to oncogene amplification and overexpression. Functional validation experiments demonstrated that mutations in genes such as FGA, PPP1R12B, and KCNJ12 significantly enhance HCC cell proliferation, migration, and invasion.

These findings not only deepen our insights into the genomics of HCC, but also open up new potential targets for diagnosis and therapy. View details>>

Candidate driver landscape

 

IF=27.4
Advanced Materials

Abstract:

During the acute inflammatory phase of tendon injury, excessive activation of macrophages leads to the overexpression of SPP1, which encodes osteopontin (OPN), thereby impairing tissue regeneration. The CRISPR-Cas13 system holds great promise for tissue repair due to its unique RNA editing and rapid degradation capabilities; however, its application has been limited by the lack of efficient delivery methods.

To address this, the researchers systematically screened various cationic polymers targeting macrophages and developed a nanocluster carrier capable of efficiently delivering Cas13 ribonucleoprotein complexes (Cas13 RNPs) into macrophages. Utilizing a reactive oxygen species (ROS)-responsive release mechanism, this system specifically suppresses the overexpression of SPP1 in macrophages within the acute inflammatory microenvironment of tendon injury.

Experimental results demonstrated that this targeted delivery strategy significantly reduced the population of SPP1-overexpressing macrophages induced by injury, inhibited fibroblast activation, and alleviated peritendinous adhesion formation. Furthermore, the study elucidated that SPP1 promotes fibroblast activation and migration through the CD44/AKT signaling pathway, and that inhibiting this pathway effectively mitigates adhesion formation following tendon injury. View details>>

Schematic diagram illustrating immune microenvironment-activated mRNA editing strategies of macrophages for PA therapy

IF=12.8
Biomaterials

Abstract:

Spinal cord injury (SCI) is a severe disabling condition that causes permanent loss of sensory, autonomic, and motor functions. While stem cell therapies, particularly mesenchymal stem cells (MSCs), show great promise for SCI treatment, their limited regenerative capacity restricts their application in tissue repair. The researchers observed that extracellular vesicles derived from antler bud progenitor cells (EVsABPC) may carry bioactive signals that promote tissue regeneration. Accordingly, they isolated and engineered EVs from ABPCs for SCI therapeutic investigation.

The study found that EVsABPC significantly enhanced neural stem cell (NSC) proliferation, promoted axonal growth, reduced neuronal apoptosis, and modulated inflammation by shifting macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype. Moreover, engineered EVsABPC modified with cell-penetrating peptides demonstrated improved targeting to the SCI lesion site, markedly enhancing neural regeneration and functional motor recovery. These findings highlight EVsABPC as a promising candidate for SCI therapy. View details>>

Graphical abstract

IF=11.3
Journal of Hazardous Materials

Abstract:

S-metolachlor (S-MET) is one of the most widely produced and applied herbicides in China. Owing to its chemical properties, it tends to persist in soil and easily contaminates surface and groundwater through leaching and runoff. This environmental persistence poses a serious threat to plant development and, through the food chain, to human health.

To address the limitations of current detection technologies and meet the growing demand for high-efficiency analytical tools, the researchers employed a mammalian expression system to generate recombinant antibodies targeting S-MET.

Building on the successful expression of these antibodies, they established a sensitive immunoassay for monitoring S-MET residues in various environmental water samples. The icELISA results showed that the recombinant antibodies retained the sensitivity, specificity, and biological activity of the original monoclonal antibodies, delivering accurate and reproducible detection in river water, agricultural runoff, and tap water. View details>>

Graphical abstract

 

IF=10.7
Biosensors and Bioelectronics

Abstract:

MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that regulate gene expression by interacting with the mRNAs of target genes. Given their crucial role in the development and progression of various diseases, miRNAs have emerged as promising biomarkers for clinical diagnostics.

In this study, researchers established a novel detection platform, termed DBmRCA, which combines dumbbell probe-initiated multi-rolling circle amplification with the high-sensitivity signal output of CRISPR/Cas12a. This enzyme-free, isothermal method enables accurate quantification of miRNA within just 30 minutes.

Clinical validation revealed that the expression levels of miR-200a and miR-126 were significantly downregulated in lung cancer tissues, and results from DBmRCA were consistent with those obtained by conventional techniques. With its high sensitivity, rapid turnaround, and simplified workflow, the DBmRCA platform presents a reliable tool for miRNA detection and holds strong promise for early diagnosis and therapeutic monitoring of lung cancer. View details>>

Graphical abstract

FAQ

Prime Editing is a novel gene editing technology that enables precise gene editing without introducing double-strand DNA breaks. It has two core components: pegRNA and the PEmax gene-editing enzyme (Cas9n-RT). PegRNA not only targets the desired sequence but also contains the base modification information. In the editing system, pegRNA guides PEmax to the designated edit site, nicks the DNA single strand, and reverse transcribes the sequence within the pegRNA to modify, inserting it into the target genome location, thereby achieving precise single-base substitutions or small insertions and deletions
EDITGENE’s newly upgraded seventh-generation Bingo™ Prime Editing (PE7) platform optimizes editing protein and RNA editing activity. Compared to the fifth-generation PE technology, point mutation success rates and gene editing efficiency have significantly improved, with one-on-one support from PhDs from globally renowned institutions.
EDITGENE’s Bingo™ Prime Editing 7 (PE7) platform is built upon over ten years of gene editing experience, with optimization and advancements derived from thousands of gene editing CRO projects, achieving significantly higher success rates than traditional site-specific mutation systems. The Bingo™ Prime platform utilizes highly efficient reverse transcriptase and precise guide RNA design, ensuring each point mutation reaches the desired outcome.
Traditional CRISPR/Cas9 technology achieves gene editing by introducing double-strand breaks at the target DNA site and then using the cell’s homologous recombination repair mechanism. This approach carries multiple risks, such as lower editing efficiency, reduced homozygous mutation rates, and random insertions or deletions. Prime Editing, however, does not require double-strand breaks. With its Cas9n-RT editing enzyme system and pegRNA, Prime Editing achieves more accurate and safer gene editing with reduced off-target effects.

Contact Us

*
*
*
*
How did you hear about us:
Contact Us
*
*
*
*
How did you hear about us: