Point Mutation Cell Line
Point mutation cell lines are generated by introducing specific SNP, single-base substitutions or small nucleotide insertions/deletions at specific sites of a target gene. This approach enables precise modeling of disease-associated mutations and facilitates the study of gene function and protein structure. Compared with conventional gene editing methods, point mutations allow refined modifications without disrupting the overall gene architecture, providing researchers with cell models that more closely reflect physiological conditions.
Leveraging our optimized CRISPR/Cas9 and Prime Editing platforms, together with efficient sgRNA design and stringent single-clone screening, EDITGENE offers customized point mutation cell lines of various types. Our services feature editing efficiencies of up to 98%, off-target rates as low as 0.1%, and comprehensive validation, helping accelerate the progress of research projects.Find 100+ Ready-to-Use mutant Cell Lines→
Service Details
| Cell Types | Various cell types, including tumor, conventional, stem, primary, and immortalized cell lines. |
|---|---|
| Services | Prime Editing / Base Editing / HDR |
| Deliverables | Gene point mutation monoclonal cell line ≥ 1 clone (2 vials per clone, 1×10^6 cells per vial) |
| Turnaround/Price |
As fast as 8 weeks,as low as $4500 |
EDI-Service Advantages
Efficient Editing System
Optimized pegRNA Design
Enhanced Cas9n-RT Enzyme
Advanced Transfection System
Streamlined Monoclonal Screening
Experienced Team
Comparison of Point Mutation Methods
| Feature | Prime Editing | Base Editing | HDR |
|---|---|---|---|
| Requirement for DSB | No (single-strand nick only) | No | Yes |
| Editing type | Point mutations, small insertions or deletions | Limited to C→T or A→G conversions | Any type (requires donor template) |
| Efficiency | High | High | Low (<10%; depends on cell division, can be improved with NHEJ inhibitors such as SCR7) |
| Applicable cells | Dividing and non-dividing cells | Dividing and non-dividing cells | Mainly dividing cells |
| Off-target risk | Low | Medium (bystander editing possible) | High (NHEJ-mediated indels) |
Service Types
Prime Editing
Working Principle

Base Editing
Working Principle

HDR
Working Principle

Case Study
Generation of Single-Base Mutation Cell Lines in A549, K562, and iPSC Cells Using Prime Editing
| Cell type | cell pool editing efficiency | Sequencing peak profile | Number of single clones selected | Number of homozygous single clones |
|---|---|---|---|---|
| A549 | 98% | WT:GAGTTGCGCATTAACAGTGGTGGGA MT:GAGTTGCGCATTAACGGTGGTGGGA ![]() |
7 | 6 |
| K562 | 82% | WT:GTGGAGAAGCCCTTCGGGAGGGACC MT:GTGGAGAAGCCCCTCGGGAGGGACC ![]() |
6 | 4 |
| IPSC | 60% | WT:AGGGAACCCCAAGTTGAACTTGGCTT MT:AGGGAACCCCAAGTTCAACTTGGCTT ![]() |
8 | 2 |
Generation of Double-Point Mutation Cell Lines in A549 Cells Using Prime Editing
| Cell type | cell pool editing efficiency | Sequencing peak profile | Number of single clones selected | Number of homozygous single clones |
|---|---|---|---|---|
| A549 | 56% and 63% | WT:CAGTCCTCAAAATCTCCATCCCTGT MT:CAGTCCTCAAAACCCCCATCCCTGT ![]() |
4 | 2 |
Generation of Base Insertion Cell Lines in Hela Cells Using Prime Editing
| Cell type | cell pool editing efficiency | Sequencing peak profile | Number of single clones selected | Number of homozygous single clones |
|---|---|---|---|---|
| Hela | 64% | WT:TCCGCTACCACCAATGCCTAATGCATTTGG MT:TCCGCTACCACCAATGCTAATAACTAATGCATTTGG ![]() |
11 | 1 |
Advantage and Characteristic
Optimazied Strategy
Optimazied Strategy
Optimazied Strategy
Optimazied Strategy
Selected Customer Resources
Deep whole-genome analysis of 494 hepatocellular carcinomas
Abstract:
To date, more than half of global hepatocellular carcinoma (HCC) cases occur in China, yet comprehensive whole-genome analyses focusing on HBV-related HCC within the Chinese population remain scarce. To address this challenge, researchers initiated the China Liver Cancer Atlas (CLCA) project, aiming to conduct large-scale whole-genome sequencing to unravel the unique pathogenic mechanisms and evolutionary trajectories of HCC in China.
The researchers performed deep whole-genome sequencing on 494 HCC tumor samples, with an average depth of 120×, alongside matched blood controls, providing a detailed genomic landscape of HBV-associated HCC. Beyond confirming well-known coding driver genes such as TP53 and CTNNB1, the study identified six novel coding drivers—including FGA—and 31 non-coding driver genes.
Additionally, the research uncovered five new mutational signatures, including SBS_H8, and characterized the presence of extrachromosomal circular DNA (ecDNA) formed via HBV integration, which contributes to oncogene amplification and overexpression. Functional validation experiments demonstrated that mutations in genes such as FGA, PPP1R12B, and KCNJ12 significantly enhance HCC cell proliferation, migration, and invasion.
These findings not only deepen our insights into the genomics of HCC, but also open up new potential targets for diagnosis and therapy. View details>>

Candidate driver landscape
Targeted Macrophage CRISPR-Cas13 mRNA Editing in Immunotherapy for Tendon Injury
Abstract:
During the acute inflammatory phase of tendon injury, excessive activation of macrophages leads to the overexpression of SPP1, which encodes osteopontin (OPN), thereby impairing tissue regeneration. The CRISPR-Cas13 system holds great promise for tissue repair due to its unique RNA editing and rapid degradation capabilities; however, its application has been limited by the lack of efficient delivery methods.
To address this, the researchers systematically screened various cationic polymers targeting macrophages and developed a nanocluster carrier capable of efficiently delivering Cas13 ribonucleoprotein complexes (Cas13 RNPs) into macrophages. Utilizing a reactive oxygen species (ROS)-responsive release mechanism, this system specifically suppresses the overexpression of SPP1 in macrophages within the acute inflammatory microenvironment of tendon injury.
Experimental results demonstrated that this targeted delivery strategy significantly reduced the population of SPP1-overexpressing macrophages induced by injury, inhibited fibroblast activation, and alleviated peritendinous adhesion formation. Furthermore, the study elucidated that SPP1 promotes fibroblast activation and migration through the CD44/AKT signaling pathway, and that inhibiting this pathway effectively mitigates adhesion formation following tendon injury. View details>>

Schematic diagram illustrating immune microenvironment-activated mRNA editing strategies of macrophages for PA therapy
Electrical stimulation of piezoelectric BaTiO3 coated Ti6Al4V scaffolds promotes anti-inflammatory polarization of macrophage and bone repair via MAPK/JNK inhibition and OXPHOS activation
Abstract:
Spinal cord injury (SCI) is a severe disabling condition that causes permanent loss of sensory, autonomic, and motor functions. While stem cell therapies, particularly mesenchymal stem cells (MSCs), show great promise for SCI treatment, their limited regenerative capacity restricts their application in tissue repair. The researchers observed that extracellular vesicles derived from antler bud progenitor cells (EVsABPC) may carry bioactive signals that promote tissue regeneration. Accordingly, they isolated and engineered EVs from ABPCs for SCI therapeutic investigation.
The study found that EVsABPC significantly enhanced neural stem cell (NSC) proliferation, promoted axonal growth, reduced neuronal apoptosis, and modulated inflammation by shifting macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype. Moreover, engineered EVsABPC modified with cell-penetrating peptides demonstrated improved targeting to the SCI lesion site, markedly enhancing neural regeneration and functional motor recovery. These findings highlight EVsABPC as a promising candidate for SCI therapy. View details>>

Graphical abstract
Generation of recombinant antibodies by mammalian expression system for detecting S-metolachlor in environmental waters
Abstract:
S-metolachlor (S-MET) is one of the most widely produced and applied herbicides in China. Owing to its chemical properties, it tends to persist in soil and easily contaminates surface and groundwater through leaching and runoff. This environmental persistence poses a serious threat to plant development and, through the food chain, to human health.
To address the limitations of current detection technologies and meet the growing demand for high-efficiency analytical tools, the researchers employed a mammalian expression system to generate recombinant antibodies targeting S-MET.
Building on the successful expression of these antibodies, they established a sensitive immunoassay for monitoring S-MET residues in various environmental water samples. The icELISA results showed that the recombinant antibodies retained the sensitivity, specificity, and biological activity of the original monoclonal antibodies, delivering accurate and reproducible detection in river water, agricultural runoff, and tap water. View details>>

Graphical abstract
Dumbbell probe initiated multi-rolling circle amplification assisted CRISPR/Cas12a for highly sensitive detection of clinical microRNA
Abstract:
MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that regulate gene expression by interacting with the mRNAs of target genes. Given their crucial role in the development and progression of various diseases, miRNAs have emerged as promising biomarkers for clinical diagnostics.
In this study, researchers established a novel detection platform, termed DBmRCA, which combines dumbbell probe-initiated multi-rolling circle amplification with the high-sensitivity signal output of CRISPR/Cas12a. This enzyme-free, isothermal method enables accurate quantification of miRNA within just 30 minutes.
Clinical validation revealed that the expression levels of miR-200a and miR-126 were significantly downregulated in lung cancer tissues, and results from DBmRCA were consistent with those obtained by conventional techniques. With its high sensitivity, rapid turnaround, and simplified workflow, the DBmRCA platform presents a reliable tool for miRNA detection and holds strong promise for early diagnosis and therapeutic monitoring of lung cancer. View details>>

Graphical abstract




