RNP Delivery

RNP delivery of the CRISPR/Cas editing system involves mixing chemically synthesized sgRNA/crRNA targeting the desired gene with Cas proteins in vitro to form a ribonucleoprotein (RNP) complex. This RNP complex is then delivered into cells via electroporation or RNP transfection reagents, allowing the sgRNA/crRNA to guide the Cas protein to the target gene for precise editing.
Advantages of RNP Delivery:
1. Low Cytotoxicity: Compared to plasmid-based delivery, RNP delivery induces much lower cytotoxicity and is rapidly degraded after gene editing is completed.
2. Broad Cell Delivery Range: Applicable to a wide range of cell types, including hard-to-transfect cells like immune and stem cells.
3. Fast and Efficient: No need to construct CRISPR/Cas expression vectors or wait for the expression of CRISPR/Cas editing components.

Service Details

Applications 1. Gene function exploration and validation
2. Disease treatment
3. Gene editing drug discovery
Turnaround/Price   Consult online for details

RNP Gene Delivery Service from EDITGENE

EDITGENE, with over ten years of gene editing experience, offers RNP gene delivery services based on our exclusive sgRNA/crRNA design strategies, self-developed high-efficiency gene editing Cas enzymes, CRISPR-EDITx™ Tran RNP transfection reagent, and a well-established RNP delivery experimental system.

EDI-Service Advantages

High-efficiency sgRNA/crRNA design and synthesis
Proprietary high-efficiency sgRNA/crRNA design algorithm; synthesis of various qualities of sgRNA/crRNA available (HPLC grade, desalting grade, etc.).
High-activity Cas proteins
Optimized Cas proteins and a well-established protein purification platform provide highly active Cas proteins.
Multiple delivery methods
Including electroporation, RNP transfection reagents, and more.
CRISPR EDITx™Tran RNP high-efficiency transfection reagent
30 minutes to complete transfection, and gene editing efficiency detectable within 48 hours.

Workflow

EDI-Service Workflow

Case Study

Using CRISPR EDITx™ Tran RNP high-efficiency transfection reagent to mediate RNP (AsCas12a + crRNA) to knock out the B2M gene in THP-1 cells.
 
· crRNA Design
crRNA: UAAUUUCUACUCUUGUAGAUCAUUCUCUGCUGGAUGACGU

B2M gene editing site diagram | EDITGENE

B2M gene editing site diagram
 
 
· Editing efficiency detection
After 48 hours of transfection, cells were collected for editing efficiency detection, and ICE Analysis showed an editing efficiency of approximately 95%.

B2M sequencing results | EDITGENE

B2M sequencing results

RNP-Mediated Gene Editing Efficiency in Selected Cell Types

Cell Type Cell Source Knockout Efficienc
THP-1 Human Monocytic Leukemia Line ★★★★
Hela Human Cervical Cancer Line ★★★★
A549 Human Non-Small Cell Lung Cancer Line ★★★
C2C12 Mouse Myoblast Line ★★★
MDA-MB-231 Human Breast Cancer Line ★★★
SNU-449 Human Liver Cancer Line ★★★
H1975 Human Lung Adenocarcinoma Line ★★★
*Knockout Efficiency(%):★★★★>81%,★★★ 51~80%
All cell types were transfected with RNP using EDITGENE’s proprietary CRISPR EDITx™Tran high-efficiency transfection reagent.

Literature Review

The CRISPR/Cas9 system is a powerful tool for genome editing, but there are certain risks associated with gene delivery strategies, as they may lead to unwanted gene editing and integration mutations in host cells. Therefore, it is crucial to develop a method that can directly and efficiently deliver the Cas9 protein complex and guide RNA (sgRNA) into the cytoplasm and subsequently transfer them into the nucleus. Mout et al. achieved this by engineering Cas9 proteins and nanoparticle carriers. They developed a system in which the Cas9 protein complex self-assembles with cationic arginine gold nanoparticles (ArgNPs) to form nanoassemblies. These nanoassemblies efficiently deliver both proteins and nucleic acids directly into the cytoplasm and transfer them to the nucleus, enabling effective gene editing.

Rational engineering of Cas9 protein and arginine nanoparticles (ArgNPs) for intracellular delivery of Cas9 protein or Cas9-RNP via membrane fusion
 
Mout R, Ray M, Yesilbag Tonga G, Lee YW, Tay T, Sasaki K, Rotello VM. Direct Cytosolic Delivery of CRISPR/Cas9-Ribonucleoprotein for Efficient Gene Editing. ACS Nano. 2017 Mar 28;11(3):2452-2458. doi: 10.1021/acsnano.6b07600. Epub 2017 Jan 31. PMID: 28129503; PMCID: PMC5848212.

Advantage and Characteristic

Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic

Selected Customer Resources

IF=50.5
Nature

Abstract:

To date, more than half of global hepatocellular carcinoma (HCC) cases occur in China, yet comprehensive whole-genome analyses focusing on HBV-related HCC within the Chinese population remain scarce. To address this challenge, researchers initiated the China Liver Cancer Atlas (CLCA) project, aiming to conduct large-scale whole-genome sequencing to unravel the unique pathogenic mechanisms and evolutionary trajectories of HCC in China.

The researchers performed deep whole-genome sequencing on 494 HCC tumor samples, with an average depth of 120×, alongside matched blood controls, providing a detailed genomic landscape of HBV-associated HCC. Beyond confirming well-known coding driver genes such as TP53 and CTNNB1, the study identified six novel coding drivers—including FGA—and 31 non-coding driver genes.

Additionally, the research uncovered five new mutational signatures, including SBS_H8, and characterized the presence of extrachromosomal circular DNA (ecDNA) formed via HBV integration, which contributes to oncogene amplification and overexpression. Functional validation experiments demonstrated that mutations in genes such as FGA, PPP1R12B, and KCNJ12 significantly enhance HCC cell proliferation, migration, and invasion.

These findings not only deepen our insights into the genomics of HCC, but also open up new potential targets for diagnosis and therapy. View details>>

Candidate driver landscape

 

IF=27.4
Advanced Materials

Abstract:

During the acute inflammatory phase of tendon injury, excessive activation of macrophages leads to the overexpression of SPP1, which encodes osteopontin (OPN), thereby impairing tissue regeneration. The CRISPR-Cas13 system holds great promise for tissue repair due to its unique RNA editing and rapid degradation capabilities; however, its application has been limited by the lack of efficient delivery methods.

To address this, the researchers systematically screened various cationic polymers targeting macrophages and developed a nanocluster carrier capable of efficiently delivering Cas13 ribonucleoprotein complexes (Cas13 RNPs) into macrophages. Utilizing a reactive oxygen species (ROS)-responsive release mechanism, this system specifically suppresses the overexpression of SPP1 in macrophages within the acute inflammatory microenvironment of tendon injury.

Experimental results demonstrated that this targeted delivery strategy significantly reduced the population of SPP1-overexpressing macrophages induced by injury, inhibited fibroblast activation, and alleviated peritendinous adhesion formation. Furthermore, the study elucidated that SPP1 promotes fibroblast activation and migration through the CD44/AKT signaling pathway, and that inhibiting this pathway effectively mitigates adhesion formation following tendon injury. View details>>

Schematic diagram illustrating immune microenvironment-activated mRNA editing strategies of macrophages for PA therapy

IF=12.8
Biomaterials

Abstract:

Spinal cord injury (SCI) is a severe disabling condition that causes permanent loss of sensory, autonomic, and motor functions. While stem cell therapies, particularly mesenchymal stem cells (MSCs), show great promise for SCI treatment, their limited regenerative capacity restricts their application in tissue repair. The researchers observed that extracellular vesicles derived from antler bud progenitor cells (EVsABPC) may carry bioactive signals that promote tissue regeneration. Accordingly, they isolated and engineered EVs from ABPCs for SCI therapeutic investigation.

The study found that EVsABPC significantly enhanced neural stem cell (NSC) proliferation, promoted axonal growth, reduced neuronal apoptosis, and modulated inflammation by shifting macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype. Moreover, engineered EVsABPC modified with cell-penetrating peptides demonstrated improved targeting to the SCI lesion site, markedly enhancing neural regeneration and functional motor recovery. These findings highlight EVsABPC as a promising candidate for SCI therapy. View details>>

Graphical abstract

IF=11.3
Journal of Hazardous Materials

Abstract:

S-metolachlor (S-MET) is one of the most widely produced and applied herbicides in China. Owing to its chemical properties, it tends to persist in soil and easily contaminates surface and groundwater through leaching and runoff. This environmental persistence poses a serious threat to plant development and, through the food chain, to human health.

To address the limitations of current detection technologies and meet the growing demand for high-efficiency analytical tools, the researchers employed a mammalian expression system to generate recombinant antibodies targeting S-MET.

Building on the successful expression of these antibodies, they established a sensitive immunoassay for monitoring S-MET residues in various environmental water samples. The icELISA results showed that the recombinant antibodies retained the sensitivity, specificity, and biological activity of the original monoclonal antibodies, delivering accurate and reproducible detection in river water, agricultural runoff, and tap water. View details>>

Graphical abstract

 

IF=10.7
Biosensors and Bioelectronics

Abstract:

MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that regulate gene expression by interacting with the mRNAs of target genes. Given their crucial role in the development and progression of various diseases, miRNAs have emerged as promising biomarkers for clinical diagnostics.

In this study, researchers established a novel detection platform, termed DBmRCA, which combines dumbbell probe-initiated multi-rolling circle amplification with the high-sensitivity signal output of CRISPR/Cas12a. This enzyme-free, isothermal method enables accurate quantification of miRNA within just 30 minutes.

Clinical validation revealed that the expression levels of miR-200a and miR-126 were significantly downregulated in lung cancer tissues, and results from DBmRCA were consistent with those obtained by conventional techniques. With its high sensitivity, rapid turnaround, and simplified workflow, the DBmRCA platform presents a reliable tool for miRNA detection and holds strong promise for early diagnosis and therapeutic monitoring of lung cancer. View details>>

Graphical abstract

FAQ

Maintaining the activity of cell cultures is crucial. Cells should not be allowed to reach confluence for more than 24 hours. Frozen new cells can restore transfection activity. The optimal cell plating density varies for different cell types or applications; however, for adherent cells, a confluence of 70% to 90% or a density of 5×10^5 to 2×10^6 suspended cells/ml typically yields good transfection results. It is important to ensure that cells are not fully confluent or in a fixed phase during transfection.
Selecting a suitable gene delivery system requires a comprehensive assessment based on specific experimental conditions, research objectives, and cell types. Quantitatively comparing various systems in terms of delivery efficiency, cytotoxicity, and stability is an important step in determining the choice.
Viral delivery systems are suitable for experiments that require high delivery efficiency and sustained gene expression, especially when cells can tolerate higher levels of cytotoxicity and immune responses. If lower cytotoxicity and immune response, along with ease of use and cost-effectiveness, are priorities, then a liposome-based gene delivery system should be chosen. For high delivery efficiency that involves delivering large DNA fragments, and if the user can accept a higher operational complexity, a gene gun delivery system is an optional method. If high delivery efficiency is needed while maintaining relative simplicity and no special equipment is required, then the electroporation delivery system may be a suitable choice.

Contact Us

*
*
*
*
How did you hear about us:
Contact Us
*
*
*
*
How did you hear about us: