搜索

Point Mutation Cell Line

There are over 75000 diseases associated with genetic variations in human, most of which are single base mutations. Therefore, constructing point mutation cell lines has great potential for application in the detection, research, and treatment of genetic diseases and cancers with single base mutations. EDITGENE used PE (Prime Edting) technology to construct avvvv point mutation cell model. The mutated Cas9 co-expressed the reverse transcriptase, which is used to recognize and cleave the DNA single strands, and the mismatch repair (MMR) mechanism is initiated to complete the repair, resulting in a successfully constructed point mutation cell line.

服务详情

Cell Types Various cell types, including tumor, conventional, stem, primary, and immortalized cell lines.
Services Model construction / Efficiency validation for therapeutic applications / DNA sourcing
Deliverables Gene point mutation monoclonal cell line ≥ 1 clone (2 vials per clone, 1×10^6 cells per vial)
Turnaround/Price 8 weeks,as low as $4500   Consult online for details
EDITGENE's newly developed Bingo™ platform is an advanced version of the Prime Editing (PE)system, the most efficient and safest tool for precise gene point mutation. This platform provides tailored services for generating highly accurate and efficient gene point mutation cell lines. Leveraging over a decade of expertise in gene editing, EDITGENE has refined its methods through thousands of gene editing CRO projects, achieving success rates that significantly exceed those of traditional gene editing systems.
 
Prime Editing Mechanism: The core mechanism of Prime Editing involves the use of a specialized guide RNA known as pegRNA. This RNA not only directs the system to the target sequence but also encodes the desired base modification. When paired with the PEmax gene-editing enzyme (Cas9n-RT), the system precisely targets the genomic site, allowing for the insertion of the desired DNA sequence, resulting in highly accurate single-nucleotide substitutions or small-scale insertions and deletions.
 
 
Technical principles of prime editing
 

EDI-Service Advantages 

Efficient Editing System
Superior editing efficiency and homozygosity rates compared to HDR-based methods.
Optimized pegRNA Design
Proprietary algorithms ensure precise and reliable pegRNA design.
Enhanced Cas9n-RT Enzyme
Optimized Cas9n-RT enzyme with improved activity and stability for superior editing outcomes.
Advanced Transfection System
Exclusive transfection system with 10x efficiency over traditional methods.
Streamlined Monoclonal Screening
3D printing technology enables efficient isolation of positive clones
Experienced Team
Expert team with over 1000 gene editing projects and experience across 300+ cell types.

Service Types

Tailored point mutation strategy design based on client requirements and comprehensive genetic analysis.
1 Construction of point mutation cell line models
2 pegRNA efficiency validation for therapeutic applications
3 Biological source material for standard DNA in in vitro diagnostics (IVD)

Workflow

Prime editing cell line service workflow | EDITGENE

Highlights of Bingo™ 7 Technology

Bingo ™ 5 is iteratively upgraded by EDITGENE and Bingo ™ 7 is officially launched with higher editing efficiency.

Improvement in editing efficiency of Bingo ™7 compared to Bingo ™5
Targeting site PE5 editing efficiency PE7 editing efficiency The fold increase in editing efficiency of PE7 compared to PE5
LPIN1 2.67
JMID7 4.71
SEC23B 3.83
TMEM41A 2.87
ACE site 1 2.54
PPPIR12B site 1 2.85
PPP1R12B site 2 1.76
TFE3 2.71
NOS3 1.59
TAF6L 1.41
CERS2
1.36
IL4R site 1
1.36
TRIM41 1.23
ODC1 1. 39
KCNI12 site 2 1. 23
KCNJ12 site 1 1. 21
IL4R site 2 1.13
 
Note:  <10%,    20%-30%,   30%-40%,   50%-60%,   70%

 
 
2)Implementing the effective editing at challenging sites
The editing efficiency of Bingo ™ 7 is very efficient, which makes it possible to edit challenging sites. We tested multiple difficult sites by using PE7 and PE5 systems, and the results showed that Bingo ™ 7 can effectively edit these sites. This means that tasks that were previously difficult to edit have become feasible, creating the possibilities for breakthrough research.
 
Sites where editing failed via Bingo ™5, but were successfully edited via Bingo ™7
Targeting site PE5 editing efficiency PE7 editing efficiency
MMACHC targeting site 1
MMACHC targeting site 2
ACE targeting site 2
ACE targeting site 3
 
Note:  <10%,    20%-30%,   30%-40%,   50%-60%,   70%-100%

 
 
3)Selected targeted mutant cells Pool Editing efficiency
Cell Cell Pool Editing Efficiency
293T
Hela
AS49
HepG2
MDA-MB-231
HCT116
U20S
Ishikawa
R28
SN4741
 
Efficiency (%):  >21%-50%,   >51-80%,   >81
 
 

Case Study

● Construction of Ishikawa Cell Line with MAPK7 Gene Point Mutation (c.A599C)

1)Project Information

Cell
Ishikawa
Gene
MAPK7(Gene ID: 5598)
Mutation Site
c.A599C
 
 

2)Bingo™ PE System Plasmid Design

Bingo™ pegRNA

Spacer

gagaactgtgagctcaagat

Extension

accaaagGcaccaatcttgagctcacagt

Bingo™ gRNA

gagccgagtgcatgtacttc

 
 

3)Polyclonal Editing Efficiency

During the polyclonal expansion phase, genome editing efficiency was assessed, with results demonstrating an approximate efficiency of 60%.
 
Editing Efficiency Assays | EDITGENE
 
Editing Efficiency Assays
 
 

4)Monoclonal Sequencing Validation

PCR amplification and subsequent sequencing analysis verified that the monoclonal clone successfully harbors the precise c.A599C nucleotide substitution.
 
Monoclonalsequencing Peak Graph | EDITGENE
 
Monoclonalsequencing Peak Graph
 
 

● Construction of Hela cell line with HSPD1 gene point mutation (c.A391G)

1)Project Information

Cell
Hela
Gene
HSPD1(GeneBank ID: 3329)
Mutation Site
c.A391G

 

2)Bingo™ PE System Plasmid Design

Bingo™ pegRNA

Spacer

ggcttcgagaagattagcaa

Extension

ttagcaccttCgctaatcttctcga

Bingo™ gRNA

agcttcttcatttgtgttat

 

3)Editing Efficiency Detection
The editing efficiency of the cell pool for the HSPD1 gene c.A391G site in HeLa cells is 71%, and homozygous mutant single-clone cells were obtained.
Editing efficiency assays
 
Sanger Sequencing Results of HSPD1 Gene c.A391G Point Mutation in HeLa Cell Pool
 
 
Editing efficiency assays
 
Sanger Sequencing Results of HSPD1 Gene c.A391G Point Mutation in HeLa Single Clone Cells
 
 

 

● Construction of HCT116 Cell Line with EGFR Gene Point Mutation (c.2319_2320 ins CAC)

 

1)Project Information

Cell
HCT116
Gene
EGFR(Gene ID: 1956)
Mutation Site
c.2319_2320 ins CAC

 

2)Bingo™ PE System Plasmid Design

Bingo™ pegRNA

Spacer

GCCCAGCAGGCGGCACACGTG

Extension

GTGGACAACCCCCACcacGTGTGCCGC

Bingo™ gRNA

GCACcacGTGTGCCGCCTGCT

 

3)Editing Efficiency Detection
Sanger sequencing results of EGFR gene point mutation (c.2319_2320 ins CAC)in HCT116 cell pool.
Editing efficiency assays
 
 
HCT116 cell line with EGFR gene point mutation shows an editing efficiency of 38% in polyclonal cells.
Editing efficiency assays
 
 

 

● Construction of HCT116 cell line with GJB2 gene point mutation (c.35 ins G)

 

 

1)Project Information

Cell
HCT116
Gene
GJB2(Gene ID: 2706)
Mutation Site
c.35 ins G

 

2)Bingo™ PE System Plasmid Design

Bingo™ pegRNA

Spacer

ACGCTGCAGACGATCCTGGG

Extension

TTTGTTCACAcCCCCCCAGGATCGTCTGCA

Bingo™ gRNA

GTGTTTGTTCACAcCCCCCC


 
3)Editing Efficiency Detection
Sanger sequencing results of GJB2 gene point mutation (c.35 ins G)in HCT116 polyclonal cell.
Editing efficiency assays
 
 
HCT116 cell line with GJB2 gene point mutation shows an editing efficiency of 56% in polyclonal cells.
Editing efficiency assays
 
 

Advantage and Characteristic

Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic

参考文献

Article Title: Structural basis for pegRNA-guided reverse transcription by a prime editor

The molecular mechanism of how the Prime editor recognizes pegRNA and interacts with target DNA remains unclear, limiting the understanding and optimization of the prime editing process. To address this, researchers determined the cryo-electron microscopy (cryo-EM) structure of the Prime editor in various states, providing a structural framework for understanding this innovative genome engineering system.
Using cryo-EM technology, researchers analyzed the Prime editor complex’s structure in different states, including pre-initiation, initiation, extension, and termination, successfully obtaining high-resolution structures that reveal dynamic changes in the reverse transcription guidance process. Based on structural information, researchers designed pegRNA and Prime editor variants, truncating and fusing M-MLV RT to create a smaller Prime editor variant (PECO-Mini) that maintained editing efficiency while increasing AAV vector titers and prime editing efficiency. Activity testing results showed that the engineered Prime editor variant has comparable activity to the original Prime editor in vitro. This study reveals the structural characteristics of the Prime editor complex in various working states, providing key information for understanding its molecular mechanism.

Article Title: A truncated reverse transcriptase enhances prime editing by split AAV vectors

Prime editing is a novel CRISPR-based genome-editing technology that does not require double-strand DNA breaks or exogenous donor template DNA, showing great potential in biomedical research and gene therapy. Despite its versatility and precision, prime editing efficiency varies across different editing types, target sites, and cell types. Therefore, to expand its applications, there is a need to improve prime editing efficiency.
Researchers screened 11 different RT variants, optimized with GenScript algorithm for human codons, which increased PE protein expression levels by 1.4-fold. By deleting the RNase H domain and further shortening the RT sequence, they created multiple truncated PECO variants, reducing the Prime editor length by 621 bp without compromising editing efficiency. To enable efficient dual-AAV delivery of PE, the team constructed a split PE system based on different Cas9 cleavage sites and inteins, identifying cleavage sites Rma 573-574 and 674-675. When these sites were paired with Rma intein, they significantly increased AAV vector titers and Prime editor efficiency. Through engineering and optimization, researchers successfully enhanced Prime editing efficiency and resolved AAV size constraints, providing a more efficient tool for future gene therapy and biomedical research.

Article Title: Structural basis for pegRNA-guided reverse transcription by a prime editor

This article elucidates the structural basis of pegRNA-guided reverse transcription in prime editing technology. High-resolution structural analysis revealed the three-dimensional conformation of key proteins in the Prime Editor, including Cas9 and reverse transcriptase, and their interaction with pegRNA. It details how pegRNA guides the Prime Editor to recognize specific DNA sequences and perform reverse transcription, inserting a predetermined gene sequence into the target site. The study also discusses the roles of key amino acid residues in pegRNA binding and reverse transcription, providing insight into the precise mechanisms of these molecular interactions. This finding not only deepens our understanding of the Prime Editing mechanism but also offers valuable structural information for optimizing and improving this technology, advancing its application in gene therapy and other fields.

Article Title: Ex vivo prime editing of patient haematopoietic stem cells rescues sickle-cell disease phenotypes after engraftment in mice

Sickle-cell disease (SCD) is an autosomal recessive genetic disorder caused by an A·T to T·A point mutation in the β-globin gene (HBB). Currently, the only FDA-approved cure for SCD is allogeneic hematopoietic stem cell transplantation; however, most patients lack ideal donors, and this procedure can lead to severe toxicity. Correcting a patient’s own hematopoietic stem cells (HSCs) can bypass immune complications and eliminate the need for matched donors. Clinical trials are ongoing to correct the SCD mutation using Cas9 nuclease-initiated homology-directed repair (HDR) and adeno-associated virus type 6 (AAV6)-delivered DNA templates.
In this article, researchers applied an optimized prime editing system to correct HSPCs from SCD patients ex vivo. By electroporating PEmax mRNA along with synthetic epegRNA and nicking sgRNA, the SCD allele (HBBS) was successfully corrected back to the wild-type (HBBA), with correction rates between 15% and 41%. Subsequently, edited HSPCs were transplanted into immunodeficient mice, and 7 weeks later, edited HSPCs maintained HBBA levels in the bone marrow, with engraftment rates, hematopoietic differentiation, and lineage maturation similar to unedited healthy donor HSPCs. Therapeutic evaluation revealed that, post-transplant, 42% of red blood cell precursors and reticulocytes expressed HBBA, exceeding the predicted therapeutic benefit level. Gene-specific analyses also confirmed high DNA specificity of the prime editing system. The study demonstrates the potential of prime editing in SCD treatment, showing its effectiveness in improving therapeutic outcomes while reducing off-target editing risks.

Article Title: Generation of Human Isogenic Induced Pluripotent Stem Cell Lines with CRISPR Prime Editing

With advancements in human molecular genetics and genomics, thousands of gene loci associated with common disease risks have been identified, often containing multiple candidate variants. However, most disease-associated variants are non-coding, making it challenging to elucidate the molecular mechanisms underlying these variants. The development of CRISPR technology provides a more precise approach for targeted genome editing, particularly prime editing, which can mediate nearly any single-nucleotide substitution. Consequently, many researchers hope to apply prime editing to study the functional relevance of specific gene variants in pluripotent stem cells, enabling the generation of isogenic cell lines to control genetic background while assessing the dose effect of causal alleles.
In this article, researchers developed an efficient CRISPR prime editing technology to generate cell lines carrying heterozygous or homozygous alleles in induced pluripotent stem cells (iPSCs) and optimized the prime editing technique. Six single-nucleotide variants (SNVs) associated with Type 2 Diabetes (T2D) risk were selected for editing, and iPSCs derived from human donors with different genetic backgrounds were edited at each site. The researchers successfully generated 27 edited iPSC clones covering 6 SNVs associated with T2D or congenital hyperinsulinemia (CHI) and found that prime editing was more efficient in iPSCs than in HEK293T cells. Overall, this study demonstrates the potential of prime editing for generating iPSCs with specific genetic backgrounds, providing a powerful tool to study the effects of specific genetic variants on disease.

精选客户文章

IF=50.5
Nature

Abstract:

To date, more than half of global hepatocellular carcinoma (HCC) cases occur in China, yet comprehensive whole-genome analyses focusing on HBV-related HCC within the Chinese population remain scarce. To address this challenge, researchers initiated the China Liver Cancer Atlas (CLCA) project, aiming to conduct large-scale whole-genome sequencing to unravel the unique pathogenic mechanisms and evolutionary trajectories of HCC in China.

The researchers performed deep whole-genome sequencing on 494 HCC tumor samples, with an average depth of 120×, alongside matched blood controls, providing a detailed genomic landscape of HBV-associated HCC. Beyond confirming well-known coding driver genes such as TP53 and CTNNB1, the study identified six novel coding drivers—including FGA—and 31 non-coding driver genes.

Additionally, the research uncovered five new mutational signatures, including SBS_H8, and characterized the presence of extrachromosomal circular DNA (ecDNA) formed via HBV integration, which contributes to oncogene amplification and overexpression. Functional validation experiments demonstrated that mutations in genes such as FGA, PPP1R12B, and KCNJ12 significantly enhance HCC cell proliferation, migration, and invasion.

These findings not only deepen our insights into the genomics of HCC, but also open up new potential targets for diagnosis and therapy. View details>>

Candidate driver landscape

 

IF=27.4
Advanced Materials

Abstract:

During the acute inflammatory phase of tendon injury, excessive activation of macrophages leads to the overexpression of SPP1, which encodes osteopontin (OPN), thereby impairing tissue regeneration. The CRISPR-Cas13 system holds great promise for tissue repair due to its unique RNA editing and rapid degradation capabilities; however, its application has been limited by the lack of efficient delivery methods.

To address this, the researchers systematically screened various cationic polymers targeting macrophages and developed a nanocluster carrier capable of efficiently delivering Cas13 ribonucleoprotein complexes (Cas13 RNPs) into macrophages. Utilizing a reactive oxygen species (ROS)-responsive release mechanism, this system specifically suppresses the overexpression of SPP1 in macrophages within the acute inflammatory microenvironment of tendon injury.

Experimental results demonstrated that this targeted delivery strategy significantly reduced the population of SPP1-overexpressing macrophages induced by injury, inhibited fibroblast activation, and alleviated peritendinous adhesion formation. Furthermore, the study elucidated that SPP1 promotes fibroblast activation and migration through the CD44/AKT signaling pathway, and that inhibiting this pathway effectively mitigates adhesion formation following tendon injury. View details>>

Schematic diagram illustrating immune microenvironment-activated mRNA editing strategies of macrophages for PA therapy

IF=12.8
Biomaterials

Abstract:

Spinal cord injury (SCI) is a severe disabling condition that causes permanent loss of sensory, autonomic, and motor functions. While stem cell therapies, particularly mesenchymal stem cells (MSCs), show great promise for SCI treatment, their limited regenerative capacity restricts their application in tissue repair. The researchers observed that extracellular vesicles derived from antler bud progenitor cells (EVsABPC) may carry bioactive signals that promote tissue regeneration. Accordingly, they isolated and engineered EVs from ABPCs for SCI therapeutic investigation.

The study found that EVsABPC significantly enhanced neural stem cell (NSC) proliferation, promoted axonal growth, reduced neuronal apoptosis, and modulated inflammation by shifting macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype. Moreover, engineered EVsABPC modified with cell-penetrating peptides demonstrated improved targeting to the SCI lesion site, markedly enhancing neural regeneration and functional motor recovery. These findings highlight EVsABPC as a promising candidate for SCI therapy. View details>>

Graphical abstract

IF=11.3
Journal of Hazardous Materials

Abstract:

S-metolachlor (S-MET) is one of the most widely produced and applied herbicides in China. Owing to its chemical properties, it tends to persist in soil and easily contaminates surface and groundwater through leaching and runoff. This environmental persistence poses a serious threat to plant development and, through the food chain, to human health.

To address the limitations of current detection technologies and meet the growing demand for high-efficiency analytical tools, the researchers employed a mammalian expression system to generate recombinant antibodies targeting S-MET.

Building on the successful expression of these antibodies, they established a sensitive immunoassay for monitoring S-MET residues in various environmental water samples. The icELISA results showed that the recombinant antibodies retained the sensitivity, specificity, and biological activity of the original monoclonal antibodies, delivering accurate and reproducible detection in river water, agricultural runoff, and tap water. View details>>

Graphical abstract

 

IF=10.7
Biosensors and Bioelectronics

Abstract:

MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that regulate gene expression by interacting with the mRNAs of target genes. Given their crucial role in the development and progression of various diseases, miRNAs have emerged as promising biomarkers for clinical diagnostics.

In this study, researchers established a novel detection platform, termed DBmRCA, which combines dumbbell probe-initiated multi-rolling circle amplification with the high-sensitivity signal output of CRISPR/Cas12a. This enzyme-free, isothermal method enables accurate quantification of miRNA within just 30 minutes.

Clinical validation revealed that the expression levels of miR-200a and miR-126 were significantly downregulated in lung cancer tissues, and results from DBmRCA were consistent with those obtained by conventional techniques. With its high sensitivity, rapid turnaround, and simplified workflow, the DBmRCA platform presents a reliable tool for miRNA detection and holds strong promise for early diagnosis and therapeutic monitoring of lung cancer. View details>>

Graphical abstract

参考文献

DOI:10.1038/s41586-024-07054-3

Abstract:

To date, more than half of global hepatocellular carcinoma (HCC) cases occur in China, yet comprehensive whole-genome analyses focusing on HBV-related HCC within the Chinese population remain scarce. To address this challenge, researchers initiated the China Liver Cancer Atlas (CLCA) project, aiming to conduct large-scale whole-genome sequencing to unravel the unique pathogenic mechanisms and evolutionary trajectories of HCC in China.

The researchers performed deep whole-genome sequencing on 494 HCC tumor samples, with an average depth of 120×, alongside matched blood controls, providing a detailed genomic landscape of HBV-associated HCC. Beyond confirming well-known coding driver genes such as TP53 and CTNNB1, the study identified six novel coding drivers—including FGA—and 31 non-coding driver genes.

Additionally, the research uncovered five new mutational signatures, including SBS_H8, and characterized the presence of extrachromosomal circular DNA (ecDNA) formed via HBV integration, which contributes to oncogene amplification and overexpression. Functional validation experiments demonstrated that mutations in genes such as FGA, PPP1R12B, and KCNJ12 significantly enhance HCC cell proliferation, migration, and invasion.

These findings not only deepen our insights into the genomics of HCC, but also open up new potential targets for diagnosis and therapy. View details>>

Candidate driver landscape

 

DOI:10.1002/adma.202311964

Abstract:

During the acute inflammatory phase of tendon injury, excessive activation of macrophages leads to the overexpression of SPP1, which encodes osteopontin (OPN), thereby impairing tissue regeneration. The CRISPR-Cas13 system holds great promise for tissue repair due to its unique RNA editing and rapid degradation capabilities; however, its application has been limited by the lack of efficient delivery methods.

To address this, the researchers systematically screened various cationic polymers targeting macrophages and developed a nanocluster carrier capable of efficiently delivering Cas13 ribonucleoprotein complexes (Cas13 RNPs) into macrophages. Utilizing a reactive oxygen species (ROS)-responsive release mechanism, this system specifically suppresses the overexpression of SPP1 in macrophages within the acute inflammatory microenvironment of tendon injury.

Experimental results demonstrated that this targeted delivery strategy significantly reduced the population of SPP1-overexpressing macrophages induced by injury, inhibited fibroblast activation, and alleviated peritendinous adhesion formation. Furthermore, the study elucidated that SPP1 promotes fibroblast activation and migration through the CD44/AKT signaling pathway, and that inhibiting this pathway effectively mitigates adhesion formation following tendon injury. View details>>

Schematic diagram illustrating immune microenvironment-activated mRNA editing strategies of macrophages for PA therapy

DOI:10.1016/j.biomaterials.2022.121990

Abstract:

Spinal cord injury (SCI) is a severe disabling condition that causes permanent loss of sensory, autonomic, and motor functions. While stem cell therapies, particularly mesenchymal stem cells (MSCs), show great promise for SCI treatment, their limited regenerative capacity restricts their application in tissue repair. The researchers observed that extracellular vesicles derived from antler bud progenitor cells (EVsABPC) may carry bioactive signals that promote tissue regeneration. Accordingly, they isolated and engineered EVs from ABPCs for SCI therapeutic investigation.

The study found that EVsABPC significantly enhanced neural stem cell (NSC) proliferation, promoted axonal growth, reduced neuronal apoptosis, and modulated inflammation by shifting macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype. Moreover, engineered EVsABPC modified with cell-penetrating peptides demonstrated improved targeting to the SCI lesion site, markedly enhancing neural regeneration and functional motor recovery. These findings highlight EVsABPC as a promising candidate for SCI therapy. View details>>

Graphical abstract

DOI:10.1016/j.jhazmat.2021.126305

Abstract:

S-metolachlor (S-MET) is one of the most widely produced and applied herbicides in China. Owing to its chemical properties, it tends to persist in soil and easily contaminates surface and groundwater through leaching and runoff. This environmental persistence poses a serious threat to plant development and, through the food chain, to human health.

To address the limitations of current detection technologies and meet the growing demand for high-efficiency analytical tools, the researchers employed a mammalian expression system to generate recombinant antibodies targeting S-MET.

Building on the successful expression of these antibodies, they established a sensitive immunoassay for monitoring S-MET residues in various environmental water samples. The icELISA results showed that the recombinant antibodies retained the sensitivity, specificity, and biological activity of the original monoclonal antibodies, delivering accurate and reproducible detection in river water, agricultural runoff, and tap water. View details>>

Graphical abstract

 

DOI:10.1016/j.bios.2024.116676

Abstract:

MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that regulate gene expression by interacting with the mRNAs of target genes. Given their crucial role in the development and progression of various diseases, miRNAs have emerged as promising biomarkers for clinical diagnostics.

In this study, researchers established a novel detection platform, termed DBmRCA, which combines dumbbell probe-initiated multi-rolling circle amplification with the high-sensitivity signal output of CRISPR/Cas12a. This enzyme-free, isothermal method enables accurate quantification of miRNA within just 30 minutes.

Clinical validation revealed that the expression levels of miR-200a and miR-126 were significantly downregulated in lung cancer tissues, and results from DBmRCA were consistent with those obtained by conventional techniques. With its high sensitivity, rapid turnaround, and simplified workflow, the DBmRCA platform presents a reliable tool for miRNA detection and holds strong promise for early diagnosis and therapeutic monitoring of lung cancer. View details>>

Graphical abstract

FAQ

What is Prime Editing?
Prime Editing is a novel gene editing technology that enables precise gene editing without introducing double-strand DNA breaks. It has two core components: pegRNA and the PEmax gene-editing enzyme (Cas9n-RT). PegRNA not only targets the desired sequence but also contains the base modification information. In the editing system, pegRNA guides PEmax to the designated edit site, nicks the DNA single strand, and reverse transcribes the sequence within the pegRNA to modify, inserting it into the target genome location, thereby achieving precise single-base substitutions or small insertions and deletions
EDITGENE’s newly upgraded seventh-generation Bingo™ Prime Editing (PE7) platform optimizes editing protein and RNA editing activity. Compared to the fifth-generation PE technology, point mutation success rates and gene editing efficiency have significantly improved, with one-on-one support from PhDs from globally renowned institutions.
EDITGENE’s Bingo™ Prime Editing 7 (PE7) platform is built upon over ten years of gene editing experience, with optimization and advancements derived from thousands of gene editing CRO projects, achieving significantly higher success rates than traditional site-specific mutation systems. The Bingo™ Prime platform utilizes highly efficient reverse transcriptase and precise guide RNA design, ensuring each point mutation reaches the desired outcome.
Traditional CRISPR/Cas9 technology achieves gene editing by introducing double-strand breaks at the target DNA site and then using the cell’s homologous recombination repair mechanism. This approach carries multiple risks, such as lower editing efficiency, reduced homozygous mutation rates, and random insertions or deletions. Prime Editing, however, does not require double-strand breaks. With its Cas9n-RT editing enzyme system and pegRNA, Prime Editing achieves more accurate and safer gene editing with reduced off-target effects.

联系我们

*
*
*
选择国家
*
来源:
联系我们
*
*
*
*
来源:
service online

  • 留言
  • You can send email to contact us.
    邮箱
  • You can send email to contact us.
    电话
    联系电话
  • This is Edgene's wechat.
    微信

  •  回到顶部