Login
Product Description
This kit is optimized for in vitro transcription using T7 RNA Polymerase. It efficiently transcribes DNA sequences downstream of a T7 promoter, using supercoiled plasmid DNA or linear DNA with a T7 promoter as a template. The kit is ideal for producing high-concentration RNA longer than 6000 nt. Using 1 μg of DNA template in a 20 μl reaction can yield 150–280 μg of RNA. For milligram-level RNA production, the reaction scale can be increased in parallel. The generated RNA is suitable for in vitro translation, RNase protection assays, RNA splicing, and hybridization probe labeling.
Product Components
| Component | JT101-01(25rxns) | JT101-02(100 rxns) |
| T7 Transcription Enzyme Mix | 50μl | 200μl |
| 5×T7Transcription Reaction Buffer | 100μl | 400μl |
| ATP(100mM) | 50μl | 200μl |
| GTP(100mM) | 50μl | 200μl |
| CTP(100mM) | 50μl | 200μl |
| UTP(100mM) | 50μl | 200μl |
| DNaseI(1 unit/ul) | 50μl | 200μl |
| 500mM EDTA(pH 8.0) | 25μl | 100μl |
| RNase-free Water | 1ml | 5ml |
| Transcription Control Template(0.5μg/μl) | 10μl | 40μl |
Template reference
T7 Promoter：5'-TAATACGACTCACTATAGGG#-3' #: G/A
Terminator：5'TTCCATCTGTTTTCTTATCTGTTCTTTCATCTGTTCTTTTATCTGTTTGTTT 3'
| Template Volume | RNA yield |
| 2μg | 170~320μg |
| 1 μg | 150~280μg |
| 500 ng | 100~180μg |
| 200 ng | 40~80μg |
| 100 ng | 15~40μg |
| 50ng | 10~20μg |
| 10ng | 4~8μg |
| lng | 2~6μg |
Reference Statistics
Storage
Store at -20℃ for one year.
联系电话
